| Primary Identifier | MGI:6153752 | Allele Type | Endonuclease-mediated |
| Attribute String | Not Specified | Gene | Nudcd3 |
| Strain of Origin | C57BL/6N | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from IMPC was generated at Welcome Trust Sanger Institute by injecting CAS9 Protein, the guide sequence CCCATGCGGTCCGAAGGGTGGCG, and a donor oligo, which resulted in a GGC to GAC (c.155G>A) change resulting in a glycine to aspartate substitution at amino acid 52. Expression of protein is substantially reduced in tissues. |
