| Primary Identifier | MGI:6153979 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Eps15l1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences CCTCCCTGTATACTGTCACCTGG and CCCAGTCTCAGCTCTGCTTATAC, which resulted in a 302 bp deletion beginning at Chromosome 8 position 72,384,676 bp and ending after 72,384,977 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000456357 (exon 10) and 158 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 262 and early truncation 3 amino acids later. |
