| Primary Identifier | MGI:6154001 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ier3ip1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTATACTTAATATCTTCACAGGG, TCAGTCTTCAGGGCTGTCAGCGG, CCATCTTTACTGAACTGAACACC and CCTTGCGTAACTTTTAAGTTACT, which resulted in a 2581 bp deletion beginning at Chromosome 18 position 76,939,313 bp and ending after 76,941,893 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001271873 and ENSMUSE00001293257 (exons 2 and 3) and 1386 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 30 and early truncation 11 amino acids later. |
