|  Help  |  About  |  Contact Us

Allele : Ier3ip1<em1(IMPC)J> immediate early response 3 interacting protein 1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6154001 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ier3ip1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTATACTTAATATCTTCACAGGG, TCAGTCTTCAGGGCTGTCAGCGG, CCATCTTTACTGAACTGAACACC and CCTTGCGTAACTTTTAAGTTACT, which resulted in a 2581 bp deletion beginning at Chromosome 18 position 76,939,313 bp and ending after 76,941,893 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001271873 and ENSMUSE00001293257 (exons 2 and 3) and 1386 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 30 and early truncation 11 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories