| Primary Identifier | MGI:6154052 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | S2bpcox16 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences ATGGAATCAGATGTGGTCTAGGG and CCAGGCAGTACTACAGGTACTGT, which resulted in a 391 bp deletion beginning at Chromosome 12 position 81,510,784 bp and ending after 81,511,174 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001300363 (exon 2) and 254 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 22 and early truncation 18 amino acids later. |