| Primary Identifier | MGI:6159653 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Sf3b3 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGACATGACGAAAACAGCCA, TTGTTGTCTGCTAACAGTAG, GACCTGAGATATTTATTGAG and CAGTGTATTTGTACAGTTAG, which resulted in a 498 bp deletion beginning at Chromosome 8 position 110,841,393 bp and ending after 110,841,890 bp (GRCm38/mm10). This mutation deletes the last 120 bp of ENSMUSE00000311482 (exon 4) and 378 bp of flanking intronic sequence including the splice donor and is predicted to cause a change of amino acid sequence after residue 150 and early truncation 7 amino acids later, probably by read through in the intron after the deletion. |
