|  Help  |  About  |  Contact Us

Allele : Sf3b3<em1(IMPC)J> splicing factor 3b, subunit 3; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6159653 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Sf3b3
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGACATGACGAAAACAGCCA, TTGTTGTCTGCTAACAGTAG, GACCTGAGATATTTATTGAG and CAGTGTATTTGTACAGTTAG, which resulted in a 498 bp deletion beginning at Chromosome 8 position 110,841,393 bp and ending after 110,841,890 bp (GRCm38/mm10). This mutation deletes the last 120 bp of ENSMUSE00000311482 (exon 4) and 378 bp of flanking intronic sequence including the splice donor and is predicted to cause a change of amino acid sequence after residue 150 and early truncation 7 amino acids later, probably by read through in the intron after the deletion.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele