| Primary Identifier | MGI:6156118 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Syt7 |
| Strain of Origin | C57BL/6NTac | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA, 3 guide sequences CCTGTAAACTATATCATCCACGG, GGGGGAGACTGTTACAGGCTAGG, TTGAGGGGGGAGACTGTTACAGG, and a donor oligo, which resulted in a Exon Deletion. |