| Primary Identifier | MGI:6156422 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Aimp1 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0944 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with four single guide RNAs having spacer sequences of GACCTTAGTACTTGTTTAAA and CACCCATGTTAAACTAAAAG targeting the 5' side and CATGCGCAGATCCCGTTAAG and TAGTTAGGGAGCGCGAGTGA targeting the 3' side of exon ENSMUSE00001354960, ENSMUSE00001356626, ENSMUSE00001346722, ENSMUSE00000175327 and ENSMUSE00000175325 resulting a 2,421-bp deletion Chr3:132671874 to 132674294 (GRCm38). |
