|  Help  |  About  |  Contact Us

Allele : Aimp1<em1(IMPC)Tcp> aminoacyl tRNA synthetase complex-interacting multifunctional protein 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6156422 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Aimp1
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0944 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with four single guide RNAs having spacer sequences of GACCTTAGTACTTGTTTAAA and CACCCATGTTAAACTAAAAG targeting the 5' side and CATGCGCAGATCCCGTTAAG and TAGTTAGGGAGCGCGAGTGA targeting the 3' side of exon ENSMUSE00001354960, ENSMUSE00001356626, ENSMUSE00001346722, ENSMUSE00000175327 and ENSMUSE00000175325 resulting a 2,421-bp deletion Chr3:132671874 to 132674294 (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

0 Driven By

5 Publication categories