| Primary Identifier | MGI:6156423 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Arid1b |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0317 was generated at The Centre for Phenogenomics by injecting Cas9 nickase (D10A) mRNA and single guide RNAs with spacer sequences of CTGCTTAGCAAGTTACCACT and GCCTGATACAGCACTTACAT targeting the 5' side and ACACTAAAGGGGTTGCTTTC and CTTGTAATCCCCCTGTAGTA targeting the 3' side of exon 5 (OTTMUSE00000314956) resulting in deletion of Chr17 from 5242523 to 5243410 with insertion of TT (GRCm38). |