|  Help  |  About  |  Contact Us

Allele : Arid1b<em1(IMPC)Tcp> AT-rich interaction domain 1B; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6156423 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Arid1b
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0317 was generated at The Centre for Phenogenomics by injecting Cas9 nickase (D10A) mRNA and single guide RNAs with spacer sequences of CTGCTTAGCAAGTTACCACT and GCCTGATACAGCACTTACAT targeting the 5' side and ACACTAAAGGGGTTGCTTTC and CTTGTAATCCCCCTGTAGTA targeting the 3' side of exon 5 (OTTMUSE00000314956) resulting in deletion of Chr17 from 5242523 to 5243410 with insertion of TT (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

0 Driven By

9 Publication categories