|  Help  |  About  |  Contact Us

Allele : Sacs<em1(IMPC)Tcp> sacsin; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6156435 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Sacs
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0556 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of AAGAAATAAGTTGCCCTCAT and ATACCTGATTGGATCAAGAT targeting the 5' side and CCAGTTGGTAGTATCCTTAG and CTTGCTCCCACTCTGAAGTG targeting the 3' side of exons ENSMUSE00000558006, ENSMUSE00000558005 and ENSMUSE00000558003. This resulted in a 6,799-bp deletion of Chr14 from 61178484 to 61185282 (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

0 Driven By

5 Publication categories