| Primary Identifier | MGI:6156438 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Aass |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with four single guide RNAs having spacer sequences of GATGAGGACCTAGGTGGGTG and GCTTCCTTAGGATACTAAGC targeting the 5' side and GTAACTCCACCTATCCTTTC and GAATGAGTGACCATTCAATA targeting the 3' side of exon ENSMUSE00000325812 and ENSMUSE00001242969 resulting in a 473-bp deletion Chr6:23114817-23115289_insGCATCAAGTGTTT (GRCm39). |