| Help | About | Contact Us

Allele : Mdm1<em1(IMPC)Kmpc> MDM1 nuclear protein; endonuclease-mediated mutation 1, Korea Mouse Phenotyping Center

Primary Identifier	MGI:6156327	Allele Type	Endonuclease-mediated
Attribute String	Null/knockout	Gene	Mdm1
Strain of Origin	C57BL/6NTac	Is Recombinase	false
Is Wild Type	false	Project Collection	IMPC

molecularNote

This allele from IMPC was generated at Korea Mouse Phenotype Consortium by injecting CAS9 Protein and the guide sequence GAACGGAACCGTCAGAAAGAAGG, which resulted in a Indel.

mutations:
Insertion,
Intergenic deletion

earliestPublication:
Son Y, et al. (2022) Mdm1 ablation results in retinal degeneration by specific intraflagellar transport defects of photoreceptor cells. Cell Death Dis 13(9):833

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

Other

2 Carried By

0 Driven By

5 Publication categories

Questions? Comments? Click here!

MouseMine is a collaboration between MGI at The Jackson Laboratory and the InterMine project at the Cambridge Systems Biology Centre. MouseMine is funded through a grant from the NIH/NHGRI.The Jackson Laboratory makes no representation about the suitability or accuracy of this software or data for any purpose, and makes no warranties, either express or implied, including merchantability and fitness for a particular purpose or that the use of this software or data will not infringe any third party patents, copyrights, trademarks, or other rights. the software and data are provided "as is". This software and data are provided to enhance knowledge and encourage progress in the scientific community and are to be used only for research and educational purposes. Any reproduction or use for commercial purpose is prohibited without the prior express written permission of the Jackson Laboratory.

Your name:
Your email address:
Subject:
Message:	---- Current page: ---- /mousemine/report.do?id=76629084

MouseMine