|  Help  |  About  |  Contact Us

Allele : Mdm1<em1(IMPC)Kmpc> MDM1 nuclear protein; endonuclease-mediated mutation 1, Korea Mouse Phenotyping Center

Primary Identifier  MGI:6156327 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Mdm1
Strain of Origin  C57BL/6NTac Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from IMPC was generated at Korea Mouse Phenotype Consortium by injecting CAS9 Protein and the guide sequence GAACGGAACCGTCAGAAAGAAGG, which resulted in a Indel.
  • mutations:
  • Insertion,
  • Intergenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele