|  Help  |  About  |  Contact Us

Allele : Kcnj11<em1H> potassium inwardly rectifying channel, subfamily J, member 11; endonuclease-mediated mutation 1, Harwell

Primary Identifier  MGI:6156348 Allele Type  Endonuclease-mediated
Attribute String  Not Specified Gene  Kcnj11
Strain of Origin  C57BL/6NTac Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA, the guide sequence targeting TACGGTACCTGGGCTCTGCAGGG, and a donor oligo. The engineered point mutation results in a change of amino acid 23 of the protein sequence from glutamic acid to lysine.
  • mutations:
  • Single point mutation
  • synonyms:
  • KCNJ11-E23K-EM1-B6N,
  • KCNJ11-E23K-EM1-B6N,
  • Kcnj11-K23,
  • Kcnj11-K23
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories