| Primary Identifier | MGI:6156348 | Allele Type | Endonuclease-mediated |
| Attribute String | Not Specified | Gene | Kcnj11 |
| Strain of Origin | C57BL/6NTac | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA, the guide sequence targeting TACGGTACCTGGGCTCTGCAGGG, and a donor oligo. The engineered point mutation results in a change of amino acid 23 of the protein sequence from glutamic acid to lysine. |
