|  Help  |  About  |  Contact Us

Allele : Zfp91<em1(IMPC)Tcp> zinc finger protein 91; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6156443 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Zfp91
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0787 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with four guide RNAs having spacer sequences of GCTATGAGTGTACCCTTGCT and AAAATTGGCATAGCCCCCAT targeting the 5' side and TCAAGCATACCTTTCAAGGT and GGTTTAATAGATCAAATGGA targeting the 3' side of exons ENSMUSE00001230146, ENSMUSE00001252442, and ENSMUSE00001304574 (exons 3-5). This resulted in a 1,493-bp deletion of Chr19 from 12777780 to 12779272 (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele