|  Help  |  About  |  Contact Us

Allele : Gpcpd1<em1(IMPC)Tcp> glycerophosphocholine phosphodiesterase 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6156444 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Gpcpd1
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR1034 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ATAATAAATCGGAGCGAGCA targeting the 5' side and GATATGTAGCCCAAACTTGG targeting the 3' side of a critical exon. This resulted in a 595-bp deletion Chr2:132546771 to 132547365_insGGGATTCC.(GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

0 Driven By

5 Publication categories