| Primary Identifier | MGI:6156445 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Hsd17b4 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0513 was generated at The Centre for Phenogenomics by injecting Cas9 endonuclease and a guide RNA with the spacer sequence GAAAGAGGAGCATTAGTCAT [and a single-strand oligonucleotide encoding the changes c.105_112delAGTCATT to inactivate the PAM sequence and prevent re-cutting of the repaired allele in ENSMUSE00001289515]. Subsequent NHEJ-mediated repair introduced an indel comprised of a 7-bp deletion of Chr18 from 50130173 to 50130179 (GRCm38) (p.V36*). |
