|  Help  |  About  |  Contact Us

Allele : Ilrun<em1(IMPC)Tcp> inflammation and lipid regulator with UBA-like and NBR1-like domains; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6156447 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ilrun
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0781 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CGTCACTACTGAGAAACTAC and CCTAAGAAAGGATTTCCCTC targeting the 5' side and ATTCTGGTAAGTGTATAACG and GACTCAGTCACACCAGGTGG targeting the 3' side of exon ENSMUSE00000449145. This resulted in a 314-bp deletion of Chr17 from 27793890 to 27794203 (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

5 Publication categories