|  Help  |  About  |  Contact Us

Allele : Cox6b1<em1(IMPC)Tcp> cytochrome c oxidase, subunit 6B1; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6156449 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Cox6b1
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0671 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of GAGCTATATACGCCTGACCT and GTGCTTAGTCGGGGTTGATT targeting the 5' side and GACCACCCAAGGGTCCCGTC and TCACCTCCAAGGGTCAAGCG targeting the 3' side of exon ENSMUSE00000516175. This resulted in a 283-bp deletion of Chr7 from 30623398 to 30623660 and an indel at Chr7:30623292_insC (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

0 Driven By

5 Publication categories