|  Help  |  About  |  Contact Us

Allele : Bckdha<em1(IMPC)Tcp> branched chain ketoacid dehydrogenase E1, alpha polypeptide; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6156450 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Bckdha
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0693 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of TAGCACCCAGGCTCTAGCAG and CCTTAACAAGCCTAGGCCTC targeting the 5' side and ACATACCTGCCTCCCGGTAC and TGCCACCTCACACTGCGTGG targeting the 3' side of exon ENSMUSE00000488731 resulting in a 266-bp deletion of Chr7 from 25638173 to 25638438, insAGAGCCT (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

0 Driven By

6 Publication categories