|  Help  |  About  |  Contact Us

Allele : Polr1b<em1(IMPC)Tcp> polymerase (RNA) I polypeptide B; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6156451 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Polr1b
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0887 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes and single guide RNA(s) with spacer sequences of GGCCGTCCCTTCCAACCAGA and GCCAACAAAGTGCAACCCTC targeting the 5' side and GGACTCGGCTACACTCAGTT and AACATCATAGAAGTGCTTAA targeting the 3' side leading to a 402-bp deletion from Chr2:129104981 to 129105382 (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

0 Driven By

5 Publication categories