|  Help  |  About  |  Contact Us

Allele : Arih1<em1(IMPC)Tcp> ariadne RBR E3 ubiquitin protein ligase 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6156459 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Arih1
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR1031 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ACAGAGGGTGAGTGCACGTA and CTTAGAGGACGTCAGGTTTT targeting the 5' side and GAGTACCTGACTATGTAAGA and TAAATCTACTAACAGGTTAC targeting the 3' side of a critical exon resulting in a 387-bp del Chr9:59436712 to 59437098 (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

0 Driven By

5 Publication categories