| Primary Identifier | MGI:6156459 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Arih1 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR1031 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ACAGAGGGTGAGTGCACGTA and CTTAGAGGACGTCAGGTTTT targeting the 5' side and GAGTACCTGACTATGTAAGA and TAAATCTACTAACAGGTTAC targeting the 3' side of a critical exon resulting in a 387-bp del Chr9:59436712 to 59437098 (GRCm38). |
