|  Help  |  About  |  Contact Us

Allele : Bdp1<em1(IMPC)Tcp> B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6156463 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Bdp1
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0880 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GATACATTGGAGAGGTGAAG and GCCAGGCATAATGAAATACA targeting the 5' side and TAAAATGGAACCTGCCACGT and CTGCCAACTATTCACTTAAA targeting the 3' side of exons ENSMUSE00000680067 and ENSMUSE00000680066 resulting in a 2,080-bp deletion Chr13:100092104 to 100094183 and a 12-bp insertion TAGGAATAAATC (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

5 Publication categories