| Primary Identifier | MGI:6156464 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Hdgfl3 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0726 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of AGCGTGTAAGCCACCAACTC and ATGATATGTGCTTATCCCAC targeting the 5' side and CTGTGATGCAAACTATTACC and GATTCAATTAATGACTCAAG targeting the 3' side of exon ENSMUSE00001263741 resulting in a 348-bp deletion of Chr7 from 81900285 to 81900632 (GRCm38). |
