|  Help  |  About  |  Contact Us

Allele : Brwd1<em1(IMPC)Tcp> bromodomain and WD repeat domain containing 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6156470 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Brwd1
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele, from project TCPR0419, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences ACGGCCGCGCGTCCCCTGCC, AAGACAGGGACGGTCAGCGG, GTCCGGCGTCCCGGGGCGAC and ACCCCGCCACCGCGAGCCCT. This resulted in a 837-bp deletion in Chr16 from 96081676 to 96082512 (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

5 Publication categories