| Primary Identifier | MGI:6156474 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Plaat5 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0672 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of GTGCATGCCAGCACTCCCTA and ACAGTTCAACAGCTTCGCCC targeting the 5' side and ATATGGGCTAAATGTGCCTC and CTCAGAAGACCTTTATTAGG targeting the 3' side of exon ENSMUSE00000237794. This resulted in a 435-bp deletion of Chr19 from 7614350 to 7614784, a 6-bp deletion of Chr19 from 7614245 to 7614250, and a 8-bp deletion of Chr19:7614932 to 7614939_insCTCTCTC. (GRCm38). |