|  Help  |  About  |  Contact Us

Allele : Plaat5<em1(IMPC)Tcp> phospholipase A and acyltransferase 5; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6156474 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Plaat5
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0672 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of GTGCATGCCAGCACTCCCTA and ACAGTTCAACAGCTTCGCCC targeting the 5' side and ATATGGGCTAAATGTGCCTC and CTCAGAAGACCTTTATTAGG targeting the 3' side of exon ENSMUSE00000237794. This resulted in a 435-bp deletion of Chr19 from 7614350 to 7614784, a 6-bp deletion of Chr19 from 7614245 to 7614250, and a 8-bp deletion of Chr19:7614932 to 7614939_insCTCTCTC. (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele