|  Help  |  About  |  Contact Us

Allele : Pwwp3a<em1(IMPC)Tcp> PWWP domain containing 3A, DNA repair factor; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6156480 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Pwwp3a
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0733 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ACAGACGCTGCCAAGGGAAC and GATCCTGCGACAACAATGAG targeting the 5' side and TTCACGCTGTGGGTTCGGGT and AAATCATACCTTAGGAGGGT targeting the 3' side resulting in a 3101-bp deletion of Chr10 from 80230041 to 80233141 (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

5 Publication categories