|  Help  |  About  |  Contact Us

Allele : Dusp16<em1(IMPC)Tcp> dual specificity phosphatase 16; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6156484 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Dusp16
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0801 was generated at The Centre for Phenogenomics by electroporation Cas9 ribonucleoprotein complexes with four guide RNAs with spacer sequences of GCTTGTATGCTACTTTTCAA and CTGTTTGAAGACCCCTTGGC targeting the 5' side and ACAGCTTTCGATTGATAGAA and GTGGACTTTCACACCTGACT targeting the 3' side of exon ENSMUSE00001282667 (exon 3). This resulted in a 1003-bp deletion of Chr6 from 134758320 to 134759322 (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

0 Driven By

5 Publication categories