| Primary Identifier | MGI:6156484 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Dusp16 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0801 was generated at The Centre for Phenogenomics by electroporation Cas9 ribonucleoprotein complexes with four guide RNAs with spacer sequences of GCTTGTATGCTACTTTTCAA and CTGTTTGAAGACCCCTTGGC targeting the 5' side and ACAGCTTTCGATTGATAGAA and GTGGACTTTCACACCTGACT targeting the 3' side of exon ENSMUSE00001282667 (exon 3). This resulted in a 1003-bp deletion of Chr6 from 134758320 to 134759322 (GRCm38). |
