| Primary Identifier | MGI:6156485 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Prdm5 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0487 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with spacer sequences CGAAGCCAGTTGGAGTGTCT and TGTTCACGAGGCACCATCTC. This resulted in a 7 bp deletion in Chr6:65831328-65831334_ACGAGGC (GRCm38). |