|  Help  |  About  |  Contact Us

Allele : Prdm5<em1(IMPC)Tcp> PR domain containing 5; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6156485 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Prdm5
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0487 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with spacer sequences CGAAGCCAGTTGGAGTGTCT and TGTTCACGAGGCACCATCTC. This resulted in a 7 bp deletion in Chr6:65831328-65831334_ACGAGGC (GRCm38).
  • mutations:
  • Insertion,
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele