| Primary Identifier | MGI:6156486 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cpvl |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0780 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TGGCTATAGTATCGCTGTGT and GGTTGAGCTCCTAACAAAAT targeting the 5' side and ATGTAGCCCAAGACTTGTAC and GCTACAACTGGTTACATTCA targeting the 3' side of exon ENSMUSE00000444358 and ENSMUSE00000444356. This resuled in a 1431-bp deletion of Chr6 from 53952328 to 53953758 with an insertion of ACCAGT (GRCm38). |
