| Primary Identifier | MGI:6156487 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Syce2 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0979 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GGCACTAAAGTAGAGATATA targeting the 5' side and CTGATAAGTACTCGTAATAC targeting the 3' side leading to a 1261-bp del Chr8:84883414 to 84884674 (GRCm38). |