|  Help  |  About  |  Contact Us

Allele : Syce2<em1(IMPC)Tcp> synaptonemal complex central element protein 2; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6156487 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Syce2
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0979 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GGCACTAAAGTAGAGATATA targeting the 5' side and CTGATAAGTACTCGTAATAC targeting the 3' side leading to a 1261-bp del Chr8:84883414 to 84884674 (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele