| Primary Identifier | MGI:6156440 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Adamtsl3 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0837 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with 4 single guide RNAs with spacer sequences of CACTTTAATCTAAGGCAAGA and GATTGCTGTAGGGCCATTGC targeting the 5' side and GTGATACCTACAGCATTCGG and GGTAGGACTTGTCTAAACAC targeting the 3' side of exon ENSMUSE00000591449 resulting in a 311-bp deletion of Chr7:82575904 to 82576214 (GRCm38). |
