| Primary Identifier | MGI:6156547 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Usp53 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR1035 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of AGTTCTGATGGCTTCAAGGT targeting the 5' side and TGAACATGTGGACTTAAACT targeting the 3' side of a critical region. This resulted in a 2,464-bp deletion Chr3:122961001 to 122963464_insC. (GRCm38). |
