| Primary Identifier | MGI:6156549 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Spred3 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0439 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of GTGGGTGTACTGGTGGCTTG and GTTAGGGAGAACGCTCAAAC targeting the 5' side and TATTGAGCTTGAGGTTGGCC and TACTGGTGTGTCACCAGGTG targeting the 3' side of a critical region. This resulted in a 1928 bp deletion & 12bp insTAAAAGGGATAA of Chr7 from 29166134 to 29168061. (GRCm38). |
