|  Help  |  About  |  Contact Us

Allele : Edc3<em1(IMPC)Tcp> enhancer of mRNA decapping 3; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6156550 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Edc3
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0903 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CTATCACTCTACCTTCCCGA and TACCTATTGAAGGAGCGAAT targeting the 5' side and TACAGGAGTTGTGCCGACGA and CCCCGTTACATGAGTAATGA targeting the 3' side of exon ENSMUSE00000751233 and ENSMUSE00000257623. This resulted in a 904-bp deletion of Chr9 from 57715453 to 57716356 with a 4-bp insertion AAGG (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

0 Driven By

5 Publication categories