| Primary Identifier | MGI:6156551 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tmem11 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0855 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TGTGCACGAAATCTACAGTG, TAATCCAGGGGCAGTGCCAA and CCGAACCAGCACCACTGGTG. This resulted in a 16-bp del Chr11:60865301 to 60865316_TGCACGAAATCTACAG; c.del89_104TGCACGAAATCTACAG; p.H31G*fs23 (GRCm38). |
