| Primary Identifier | MGI:6156557 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Sertad3 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0978 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GGATAAGGACGTGCCTGCGG, GGAACCGATGGTGGTAGATA, and GGGCGTCAGCCTCAGTGCGC. This resulted in a 338-bp deletion Chr7:27476275 to 27476612 (GRCm38). |