|  Help  |  About  |  Contact Us

Allele : Sertad3<em1(IMPC)Tcp> SERTA domain containing 3; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6156557 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Sertad3
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0978 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GGATAAGGACGTGCCTGCGG, GGAACCGATGGTGGTAGATA, and GGGCGTCAGCCTCAGTGCGC. This resulted in a 338-bp deletion Chr7:27476275 to 27476612 (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele