|  Help  |  About  |  Contact Us

Allele : Nav2<em1(IMPC)Tcp> neuron navigator 2; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6156559 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Nav2
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0783 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CGGCCCTCCCTTGTCTAAAA and CGTCACCAGAGGCATAAATG targeting the 5' side and GGCGCTGCCGACCCATCTTC and CCAATCAGACCAGTGGCGCT targeting the 3' side of a critical region. This resulted in a 473-bp deletion of Chr7 from 49408477 to 49408949 and a 271-bp deletion of Chr7 from 49409000 to 49409270 (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

0 Driven By

5 Publication categories