| Primary Identifier | MGI:6156559 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Nav2 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0783 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CGGCCCTCCCTTGTCTAAAA and CGTCACCAGAGGCATAAATG targeting the 5' side and GGCGCTGCCGACCCATCTTC and CCAATCAGACCAGTGGCGCT targeting the 3' side of a critical region. This resulted in a 473-bp deletion of Chr7 from 49408477 to 49408949 and a 271-bp deletion of Chr7 from 49409000 to 49409270 (GRCm38). |
