|  Help  |  About  |  Contact Us

Allele : Zc3h12b<em1(IMPC)Tcp> zinc finger CCCH-type containing 12B; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6156569 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Zc3h12b
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0676 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and three guide RNAs with spacer sequences of AGCAAGTTGTATTCCCCTGC and CGCCCCGATGCACCAATTAC targeting the 5' side and CTCGGACCATGGCGTCCAAG targeting the 3' side of exons ENSMUSE00000842756 and ENSMUSE00001286785 resulting in a 2915-bp deletion of ChrX from 95922379 to 95925293. (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

0 Driven By

5 Publication categories