| Primary Identifier | MGI:6156572 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Mettl14 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0863 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TCTGTCAGCTAAACCTAAGG targeting the 5' side and ATAAGCGTGTACTCTCTGGG and GATTAGTGAGATCATCTGAT targeting the 3' side. This resulted in a 1,678-bp deletion from Chr3:123374566 to 123376243_insT (GRCm38). |
