|  Help  |  About  |  Contact Us

Allele : Alg6<em1(IMPC)Tcp> ALG6 alpha-1,3-glucosyltransferase; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6156575 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Alg6
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0899 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes containing 4 guide RNAs with spacer sequences of GGACATTTGGAGTATCCAGA and GTGCTCTTGCCGCTTTGAGT targeting the 5' side GGTCTTATTCTTATCGACTA and CCTAGATCATAATATGTAAC targeting the 3' side of exons ENSMUSE00001275430 and ENSMUSE00001257593 resulting in a 1479-bp del in Chr4:99740974 to 99742452_insATGGTTTA (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

5 Publication categories