| Primary Identifier | MGI:6156575 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Alg6 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0899 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes containing 4 guide RNAs with spacer sequences of GGACATTTGGAGTATCCAGA and GTGCTCTTGCCGCTTTGAGT targeting the 5' side GGTCTTATTCTTATCGACTA and CCTAGATCATAATATGTAAC targeting the 3' side of exons ENSMUSE00001275430 and ENSMUSE00001257593 resulting in a 1479-bp del in Chr4:99740974 to 99742452_insATGGTTTA (GRCm38). |
