|  Help  |  About  |  Contact Us

Allele : G2e3<em1(IMPC)Tcp> G2/M-phase specific E3 ubiquitin ligase; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6156577 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  G2e3
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0802 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TCTATTTACCCTCGTACCCA and GTACAGGATGCTAGACTATA targeting the 5' side and AGTGTAATAGGCTCCAAGAG and ACTCACTGAAAACAGTCCGG targeting the 3' side of exon ENSMUSE00000312307 resulting in a 538-bp deletion of Chr12 from 51356764 to 51357301 (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

0 Driven By

5 Publication categories