| Primary Identifier | MGI:6156577 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | G2e3 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0802 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TCTATTTACCCTCGTACCCA and GTACAGGATGCTAGACTATA targeting the 5' side and AGTGTAATAGGCTCCAAGAG and ACTCACTGAAAACAGTCCGG targeting the 3' side of exon ENSMUSE00000312307 resulting in a 538-bp deletion of Chr12 from 51356764 to 51357301 (GRCm38). |
