|  Help  |  About  |  Contact Us

Allele : Zfp629<em1(IMPC)Tcp> zinc finger protein 629; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6156578 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Zfp629
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR1036 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CATAGGGGTCTGGTGATCTA and GAGGGTTCCCCACTGCCAAT targeting the 5' side and CGTGTCAGGACATCCACCAC and GCGGAACTTGCTCATGGAAC targeting the 3' side of a critical region. This resulted in a 3716-bp deletion from Chr7:127608671 to 127612386; (predicted effect on protein p.P84X.) (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

0 Driven By

5 Publication categories